Review



transit x2 dynamic delivery 310 system  (Mirus Bio)


Bioz Verified Symbol Mirus Bio is a verified supplier
Bioz Manufacturer Symbol Mirus Bio manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 98

    Structured Review

    Mirus Bio transit x2 dynamic delivery 310 system
    Transit X2 Dynamic Delivery 310 System, supplied by Mirus Bio, used in various techniques. Bioz Stars score: 98/100, based on 2305 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/transit+x2+dynamic+delivery+310+system/TransIT-X2/10__1128_slash_iai__00303___18-169-25-32
    Average 98 stars, based on 2305 article reviews
    transit x2 dynamic delivery 310 system - by Bioz Stars, 2026-09
    98/100 stars

    Images

    Related Articles

    Transfection:

    Article Title: EspH Suppresses Erk by Spatial Segregation from CD81 Tetraspanin Microdomains
    Article Snippet: .. To achieve this, HeLa cells were 308 transfected with the pSpCas9 (BB)-2A-GFP (PX458) plasmid, into which the sgRNA 309 (GCTGGCTGGAGGCGTGATCC) had been subcloned, using the TransIT-X2 dynamic delivery 310 system (MIR 6004, Mirus, Madison, WI). ..

    Plasmid Preparation:

    Article Title: EspH Suppresses Erk by Spatial Segregation from CD81 Tetraspanin Microdomains
    Article Snippet: .. To achieve this, HeLa cells were 308 transfected with the pSpCas9 (BB)-2A-GFP (PX458) plasmid, into which the sgRNA 309 (GCTGGCTGGAGGCGTGATCC) had been subcloned, using the TransIT-X2 dynamic delivery 310 system (MIR 6004, Mirus, Madison, WI). ..



    Similar Products

    98
    Mirus Bio transit x2 dynamic delivery 310 system
    Transit X2 Dynamic Delivery 310 System, supplied by Mirus Bio, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/transit+x2+dynamic+delivery+310+system/TransIT-X2/10__1128_slash_iai__00303___18-169-25-32
    Average 98 stars, based on 1 article reviews
    transit x2 dynamic delivery 310 system - by Bioz Stars, 2026-09
    98/100 stars
      Buy from Supplier

    Image Search Results