transit x2 dynamic delivery 310 system (Mirus Bio)
98
Structured Review
Mirus Bio
transit x2 dynamic delivery 310 system
Transit X2 Dynamic Delivery 310 System, supplied by Mirus Bio, used in various techniques. Bioz Stars score: 98/100, based on 2305 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/transit+x2+dynamic+delivery+310+system/TransIT-X2/10__1128_slash_iai__00303___18-169-25-32
Average 98 stars, based on 2305 article reviews
Transit X2 Dynamic Delivery 310 System, supplied by Mirus Bio, used in various techniques. Bioz Stars score: 98/100, based on 2305 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/transit+x2+dynamic+delivery+310+system/TransIT-X2/10__1128_slash_iai__00303___18-169-25-32
Average 98 stars, based on 2305 article reviews
transit x2 dynamic delivery 310 system - by Bioz Stars,
2026-09
98/100 stars
Images
Related Articles
Transfection:Article Title: EspH Suppresses Erk by Spatial Segregation from CD81 Tetraspanin Microdomains Article Snippet: .. To achieve this, HeLa cells were 308 transfected with the pSpCas9 (BB)-2A-GFP (PX458) plasmid, into which the sgRNA 309 (GCTGGCTGGAGGCGTGATCC) had been subcloned, using the Plasmid Preparation:Article Title: EspH Suppresses Erk by Spatial Segregation from CD81 Tetraspanin Microdomains Article Snippet: .. To achieve this, HeLa cells were 308 transfected with the pSpCas9 (BB)-2A-GFP (PX458) plasmid, into which the sgRNA 309 (GCTGGCTGGAGGCGTGATCC) had been subcloned, using the |